Notice: the solgenomics has been unstable, we apologize for the inconvenience.

EST details — SGN-E394251

Search information 
Request: 394251Match: SGN-E394251
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C172779Clone name: TUS-14-G17
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C172779 is on microarray TOM1 spot ID 1-1-8.3.20.10 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C10934 [cLEC-6-K8] Trace: SGN-T24138 EST: SGN-E202477 Direction: 5' Facility: TIGR
Clone: SGN-C172779 [TUS-14-G17] Trace: SGN-T195120 EST: SGN-E393794 Direction: 3' Facility: INRA
Clone: SGN-C172779 [TUS-14-G17] Trace: SGN-T195308 EST: SGN-E393982 Direction: 5' Facility: INRA
Clone: SGN-C172779 [TUS-14-G17] Trace: SGN-T195576 EST: SGN-E394250 Direction: 3' Facility: INRA
Clone: SGN-C172779 [TUS-14-G17] Trace: SGN-T195576 EST: SGN-E398937 Direction: 3' Facility: INRA
Clone: SGN-C172779 [TUS-14-G17] Trace: SGN-T195577 EST: SGN-E398938 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E394251Length: 666 bp (871 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E394251 [] (trimmed) ATAATAAAGATCTTACACTAAAAGACTAGAACTACTAAATAGTACATCCAACAAAACAAACAAAGGGCTACACAGTTGCTTTGCCAAATTTTCTA
TTGAACAAAGTTATGTATTTTTTTCTATGCAAAAGTAAACAATAGAAACAGTTTCAATCAAATCTAATTAATAATTATCAATATCATCCCCACTA
CAACATTATACAAACAACAAATAAAAATTTAAAAACCCAAACTAAAGTCATACAATTTTGTAACCAGCACCCCCTTTAGCCATTTCAACAGCAGT
TCCATTCCTAGTTCCAGGATAATCAACTTCAGTCATGAACTTAGACCAGAACCAATGTTCTTTCCACACAATCACCATCTCTTCTATCGGAATAT
TTTTCGTCTCAGGCAAGAAGAAGTATATGAACACAGTCATAATCACCACAAAGAAGGCGAAAAACAGAAACAATCCAAACTTCAAATGACACAAC
ATTGTTAAGAAAACTTGTGCTACTGCAAATGTGAAGATCATGTTCACTGAGACATTGATACTTTGTGCAGCTGATCGAATTTCCAGTGGGAAAAT
TTCACTAAGTACGAGCCATCCAAGAGGACCCCATGACCAAGCGAATCCAGCAACATATACACAAATGAATATCACAACCACTATTGCATACCATT
T
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E394251] SGN-U584262 Tomato 200607 Build 2 17 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T195577 [Download][View] Facility Assigned ID: FA0AAD2AD09RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read -- flanking 5' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.927 Expected Error Rate: 0.0042 Quality Trim Threshold: 12.5