EST details — SGN-E394248

Search information 
Request: 394248Match: SGN-E394248
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C172775Clone name: TUS-14-G13
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C172775 is on microarray TOM1 spot ID 1-1-4.3.20.6 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C172775 [TUS-14-G13] Trace: SGN-T195119 EST: SGN-E393793 Direction: 3' Facility: INRA
Clone: SGN-C172775 [TUS-14-G13] Trace: SGN-T195306 EST: SGN-E393980 Direction: 3' Facility: INRA
Clone: SGN-C172775 [TUS-14-G13] Trace: SGN-T195306 EST: SGN-E398933 Direction: 3' Facility: INRA
Clone: SGN-C172775 [TUS-14-G13] Trace: SGN-T195307 EST: SGN-E393981 Direction: 5' Facility: INRA
Clone: SGN-C172775 [TUS-14-G13] Trace: SGN-T195574 EST: SGN-E398934 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E394248Length: 374 bp (913 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E394248 [] (trimmed) GATAAATATCTGTCATATATATATATATATATAATACATGATGTAGTTTTTACCCAAGTTACCACATATTGAAGTAGTAGTATGTACAAAATTAG
GAAATTGCTCTGTTTTCATATATTGTTATTAGTCTCAAACAATCACACAACTATGTTTGTTTGTGTTGTTACCATCATAACATTTTGCATAGCTA
GAGCATTACTAGTACCCATCGGAATATGGCCGTTATCGTTACTGTTTTTCTCCGTCTTCTTTAATTCTTTCAGTTCTCTCGCCCTCGCTCTCCAG
TTCCAGAAAGTTCCAAACAATGTTTCCATTTCTTCTAGAGTCTTCCCTTGAGTTTTTTTTTTTTTTTGAGTACAAAAACACCAATTTTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E394248] SGN-U565600 Tomato 200607 Build 2 65 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T195574 [Download][View] Facility Assigned ID: FA0AAD2AD07RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.917 Expected Error Rate: 0.0046 Quality Trim Threshold: 14.5