Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E394062

Search information 
Request: 394062Match: SGN-E394062
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C172822Clone name: TUS-14-I12
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C172822 is on microarray TOM1 spot ID 1-1-5.1.20.7 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C11002 [cLEC-6-N7] Trace: SGN-T24191 EST: SGN-E202530 Direction: 5' Facility: TIGR
Clone: SGN-C172822 [TUS-14-I12] Trace: SGN-T195387 EST: SGN-E394061 Direction: 3' Facility: INRA
Clone: SGN-C172822 [TUS-14-I12] Trace: SGN-T195387 EST: SGN-E399066 Direction: 3' Facility: INRA
Clone: SGN-C172822 [TUS-14-I12] Trace: SGN-T195681 EST: SGN-E394355 Direction: 5' Facility: INRA
Clone: SGN-C172822 [TUS-14-I12] Trace: SGN-T195681 EST: SGN-E399067 Direction: 5' Facility: INRA
Clone: SGN-C172822 [TUS-14-I12] Trace: SGN-T199455 EST: SGN-E398129 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E394062Length: 416 bp (886 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E394062 [] (trimmed) AGGTCATGAAGCTGCCTCTTGCTGGAGTAGAGGCTATTTTGTTCAGTGATGACCTTCAGATCGCCTCAGAGGATGCAGTGTATGACTTTGTGTTG
AAGTGGACAAGGACTCATTATCCACAGTTAGAGGAACGGCGAGAAATCCTTAGTTCACGACTTGGTCGTTGCATCCGTTTTCCTTTTATGAGCTG
TAGAAAGCTTCGGAAGGTTCTGGCATGTAATGACTTTGATCACGAATTTGCATCCAAGCTTGTGCTTGAGGCTCTCTTTTATAAAGCTGAGGCTC
CTCATCGTCAGCGAAGCCAAGCTGCAGAAGACTCGTCCTCCACTAGTCATCGTTTCGTGGAACGTGCTTACAAGTATCGACCTGTGAAGGTGGTT
GATTTTGGACTTCCACGGCAACAATGGGTGGGGGGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E394062] SGN-U571708 Tomato 200607 Build 2 39 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T195388 [Download][View] Facility Assigned ID: FA0AAD2BE06RM2
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.966 Expected Error Rate: 0.0001 Quality Trim Threshold: 14.5