Notice: the solgenomics has been unstable, we apologize for the inconvenience.

EST details — SGN-E394012

Search information 
Request: 394012Match: SGN-E394012
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C183121Clone name: TUS-41-F15
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C183121 is on microarray TOM1 spot ID 1-1-2.2.3.9 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C183121 [TUS-41-F15] Trace: SGN-T195179 EST: SGN-E393853 Direction: 3' Facility: INRA
Clone: SGN-C183121 [TUS-41-F15] Trace: SGN-T195337 EST: SGN-E394011 Direction: 3' Facility: INRA
Clone: SGN-C183121 [TUS-41-F15] Trace: SGN-T195337 EST: SGN-E398858 Direction: 3' Facility: INRA
Clone: SGN-C183121 [TUS-41-F15] Trace: SGN-T200154 EST: SGN-E398859 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E394012Length: 311 bp (874 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E394012 [] (trimmed) AGAAGATTGAGGATTCATGGATACCAGAAATGTGTAAGATGAGGTTAATGCTGAGATTGGTGCTTCTTTAATCTGATGAGAAAATGTTCATTGTT
TGGACTGCATTTGACTTGCAATTCTGTGCATAAAGGAATGTTAGGTTTTATTGCATTGTTGTTTATAAATAAACTTGTATTACAAAGGGAGCAAT
TGAGGAGAATTCTGAAAGACTTCTCTTCTATTTATCAAGAACTGATGTGACAAGTCACAAGTACTTGGAATTATAAATGTCACACAGGAGTGAGG
ACCATGACTTGTTTTTCGGGTGTTAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E394012] SGN-U568246 Tomato 200607 Build 2 14 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T195338 [Download][View] Facility Assigned ID: FA0AAD29CC08RM2
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.918 Expected Error Rate: 0.0028 Quality Trim Threshold: 14.5