Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E393940

Search information 
Request: 393940Match: SGN-E393940
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C172978Clone name: TUS-14-O24
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C172978 is on microarray TOM1 spot ID 1-1-1.3.20.12 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C14408 [cLEC-7-M9] Trace: SGN-T25400 EST: SGN-E202118 Direction: 5' Facility: TIGR
Clone: SGN-C172978 [TUS-14-O24] Trace: SGN-T195414 EST: SGN-E394088 Direction: 3' Facility: INRA
Clone: SGN-C172978 [TUS-14-O24] Trace: SGN-T195414 EST: SGN-E399113 Direction: 3' Facility: INRA
Clone: SGN-C172978 [TUS-14-O24] Trace: SGN-T195415 EST: SGN-E394089 Direction: 5' Facility: INRA
Clone: SGN-C172978 [TUS-14-O24] Trace: SGN-T195710 EST: SGN-E394384 Direction: 5' Facility: INRA
Clone: SGN-C172978 [TUS-14-O24] Trace: SGN-T195710 EST: SGN-E399114 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E393940Length: 610 bp (838 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E393940 [] (trimmed) GGGGGAAAGGGGGTCCTGGGAATTCCCTTCCTCCAAAAATTTTACTAAAAACTAAAAACCAAACCCCAAAAAATCCTTTCCAAAAGGCCTTTTGA
AAACCCTGAAATCCCATGAAACCACACCCTCCGCTCTATCCCCATGCCCATTCCACAACTTCCACAACTCCCTAACTTTCCCTTTTGGTGTTTCC
CTACAACCCACTTGGAGTATCCCCCAAAACTTTTGAAAAGCCCCCACTTGAAATGCTTCCACAAAAAAACCCCAAACCCCCTTATTTTCCTTCCT
GCCTAAAAACCTCCCTAAAATTGAAACTGAAAATTCCGTAACCCAATCTGAAACTCCCCACAATTTCTTCCCCCAAACAGGGCCCCTAAATGCAT
AACTAAAAACCCCTTTCCCCCCCTCTTCCTACCCCCAAAGACCCGCCCAAACACCCAAAGCCTTTTCCCATATGCTTTTGTCCCAATTCCCAAGT
ATTTCTATCAACATTTCCACTAACCCCCCATCCACCAATCTTGATCTTGAAGAATGGGAAGAAGAATTATTAACCCTATAAAAAATTGGTAAAAA
AAAAACTTTTGTAGTATTAAGAAAAATTGGGTCTTTTACC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E393940] SGN-U564405 Tomato 200607 Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T195266 [Download][View] Facility Assigned ID: FA0AAD2BH12FM2
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.867 Expected Error Rate: 0.0316 Quality Trim Threshold: 14.5