EST details — SGN-E393851

Search information 
Request: 393851Match: SGN-E393851
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C183111Clone name: TUS-41-F5
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C183111 is on microarray TOM1 spot ID 1-1-4.2.3.5 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C68013 [cLEN-22-J21] Trace: SGN-T91669 EST: SGN-E276973 Direction: 5' Facility: TIGR
Clone: SGN-C183111 [TUS-41-F5] Trace: SGN-T195178 EST: SGN-E393852 Direction: 5' Facility: INRA
Clone: SGN-C183111 [TUS-41-F5] Trace: SGN-T195816 EST: SGN-E394490 Direction: 3' Facility: INRA
Clone: SGN-C183111 [TUS-41-F5] Trace: SGN-T195816 EST: SGN-E398856 Direction: 3' Facility: INRA
Clone: SGN-C183111 [TUS-41-F5] Trace: SGN-T200153 EST: SGN-E398857 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E393851Length: 345 bp (872 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E393851 [] (trimmed) GAAAGGAATATAGTATGAGGGTGAAGAACAGAGTATATATAGAGATGGATATTCCTAGTTTGTTTTCTGGAAACTTAATTATTTACTTCTCCTAC
AATTTAAGGGTTTTATTTCCTATTTTATTTACTTCTCCTACTATTTAAGGATTTAATTTCCTATTTTTGCTTTGTTTTGGAAACTTAAGGCGGAA
ACAAAAAGTTTCCTATTTTGTTATTTCTCCTTGTTTCTTTAGGAATGGTAAGGTAAAGAGAAGTAAAGGGAACATAATTAGTTTCCCACTAATAT
ATTATTTTTATTGTAAATAGAGGATATTTAAATTGTTAATACAAAAGAAGATATTTTTTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E393851] SGN-U568568 Tomato 200607 Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T195177 [Download][View] Facility Assigned ID: FA0AAD29CC03FM2
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.877 Expected Error Rate: 0.0006 Quality Trim Threshold: 14.5