EST details — SGN-E393840

Search information 
Request: 393840Match: SGN-E393840
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C183021Clone name: TUS-41-B11
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C183021 is on microarray TOM1 spot ID 1-1-6.2.3.8 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C67213 [cLEN-17-N18] Trace: SGN-T90906 EST: SGN-E276485 Direction: 5' Facility: TIGR
Clone: SGN-C183021 [TUS-41-B11] Trace: SGN-T195165 EST: SGN-E393839 Direction: 3' Facility: INRA
Clone: SGN-C183021 [TUS-41-B11] Trace: SGN-T195809 EST: SGN-E394483 Direction: 3' Facility: INRA
Clone: SGN-C183021 [TUS-41-B11] Trace: SGN-T195809 EST: SGN-E398840 Direction: 3' Facility: INRA
Clone: SGN-C183021 [TUS-41-B11] Trace: SGN-T200140 EST: SGN-E398841 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E393840Length: 547 bp (863 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E393840 [] (trimmed) AGAAGATTGAGGATTCATGGATACCAGAAATGTGTAAGATGAGGTTAATGCTGAGATTGGTGCTTCTTTAATCTGATGAGAAAATGTTCATTGTT
TGGACTGCATTTGACTTGCAATTCTGTGCATAAAGGAATGTTAGGTTTTATTGCATTGTTGTTTATAAATAAACTTGTATTACAAAGGGAGCAAT
TGAGGAGAATTCTGAAAGACTTCTCTTCTATTTATCAAGAACTGATGTGACAAGTCACAAGTACTTGCAATTATAAATGTCACACAGGAGTGAGG
ACCATGAATTGGCTTTCTGGTGTTATATCCCACATATTTCCGTGTCTATGATTTCTGGATTCAATTTTGAAGTTTCTTCGCAGAATTATTAGGAT
CTGTTGCTAGTAATCCAGGGCAAAATTCAACATCCGGCGCCAAGGGGTGAGTTCTCACTTCCAAGTGCTGCCTCCAAAATTGGTTTGTGGATAGC
CATAAACCCTGTATGGTGTAAAATATGTTGGCTTAATGTCTGTATCCTTTGAGATTTACCATTTGTTCTTGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E393840] SGN-U568246 Tomato 200607 Build 2 14 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T195166 [Download][View] Facility Assigned ID: FA0AAD29CA06RM2
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.955 Expected Error Rate: 0.0038 Quality Trim Threshold: 14.5