EST details — SGN-E393816

Search information 
Request: 393816Match: SGN-E393816
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C172911Clone name: TUS-14-M5
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C172911 is on microarray TOM1 spot ID 1-1-4.1.20.4 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C14271 [cLEC-7-G14] Trace: SGN-T25424 EST: SGN-E202142 Direction: 5' Facility: TIGR
Clone: SGN-C172911 [TUS-14-M5] Trace: SGN-T195141 EST: SGN-E393815 Direction: 3' Facility: INRA
Clone: SGN-C172911 [TUS-14-M5] Trace: SGN-T195142 EST: SGN-E398975 Direction: 5' Facility: INRA
Clone: SGN-C172911 [TUS-14-M5] Trace: SGN-T195321 EST: SGN-E393995 Direction: 3' Facility: INRA
Clone: SGN-C172911 [TUS-14-M5] Trace: SGN-T195321 EST: SGN-E398974 Direction: 3' Facility: INRA
Clone: SGN-C172911 [TUS-14-M5] Trace: SGN-T195322 EST: SGN-E393996 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E393816Length: 344 bp (881 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E393816 [] (trimmed) ACTGCAAAACATCCTCTTAATATTCTATTAAATTGTTTGCAACAATTTGAACTTTTCTAAATAAAGGAAATATTTCTTGCAAAAAAACAAAAACT
ATTTTAGTAAATAGTTTTTATATATTCCTTTTTAAATTATTCTGGTAAAAAAAAAAGTTACTTATCCTTTTTACCAGAATCATTAAAAAGCTTAG
GATCAGTTTGATAATAAACAATATCTCCATTGTCACTAACATAATGATCCTTCTTCATGCTTTTCACTAAATTTTCAACCAAATGAAATGGAATT
GCCCCTGATTTTTTTGGCTCTCTATAATATTTTCCAAATACTGGCTTTGCTGGCTTTTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E393816] SGN-U575508 Tomato 200607 Build 2 56 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T195142 [Download][View] Facility Assigned ID: FA0AAD2AG03RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.865 Expected Error Rate: 0.0060 Quality Trim Threshold: 14.5