EST details — SGN-E393725

Search information 
Request: 393725Match: SGN-E393725
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C183626Clone name: TUS-42-K16
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C183626 is on microarray TOM1 spot ID 1-1-1.3.1.4 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C68525 [cLEN-6-M11] Trace: SGN-T88228 EST: SGN-E273532 Direction: 5' Facility: TIGR
Clone: SGN-C183626 [TUS-42-K16] Trace: SGN-T195050 EST: SGN-E393724 Direction: 5' Facility: INRA
Clone: SGN-C183626 [TUS-42-K16] Trace: SGN-T195050 EST: SGN-E399295 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E393725Length: 291 bp (857 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E393725 [] (trimmed) CTTTTCTTGCACTGGTATCTATTGTGCCGAATACTCTTCCTATTATCCATGAGATTTTTACTAGCCCTGATCCGTTACCATTTCCTCATACTAAT
CCTTTGGCAAGGATGATGAATACTGTTGGTAGATATATTCCCCCTTAAGTATTTGCTGTTCTTGTACCGCTTTTACTCCTCTCAAATTTTACTAA
TGACTGGGCTGAACTGTCTACTAGAAGTTATGCGGTTATGGTTCTGGTTCTCCCGATGAATGGCTTAAGAAAGTGGCGTGAACATGACTTAGAAC
TTGTGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E393725] SGN-U580514 Tomato 200607 Build 2 19 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T195051 [Download][View] Facility Assigned ID: FA0AAD30BF08RM2
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.954 Expected Error Rate: 0.0406 Quality Trim Threshold: 14.5