EST details — SGN-E393680

Search information 
Request: 393680Match: SGN-E393680
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C183388Clone name: TUS-42-A18
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C183388 is on microarray TOM1 spot ID 1-1-7.1.1.6 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C31643 [cLEG-14-M13] Trace: SGN-T66477 EST: SGN-E251820 Direction: 5' Facility: TIGR
Clone: SGN-C183388 [TUS-42-A18] Trace: SGN-T196003 EST: SGN-E394677 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E393680Length: 293 bp (881 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E393680 [] (trimmed) ATTTTTTCTTTTATGCTAAGAGCCCTTTTCTCTGCTGAAGAAATCTCCTCTATGGTTCTTATTATTATGAAGGAGATAGCTGAGGCTTTTCTTGG
AACAACAATAAAGAATGCTGTTGTTACTGTGCCTGCGTATTTCAATGACTCTCAACGTCAAGCTACTAATGATGCTGGAACTATTTCTGGGCTCA
AAGTTATGCATATTATCTTCTAGCCTACTGCTGCTGCAATTGCTTATGGACTTGATAAGAAATCAAGTATTTCAAGGGAGACAACTGTGCTTTTT
TTTTAAAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E393680] SGN-U579872 Tomato 200607 Build 2 71 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T195006 [Download][View] Facility Assigned ID: FA0AAD30BA09FM2
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.905 Expected Error Rate: 0.0124 Quality Trim Threshold: 20.5