EST details — SGN-E393679
Search information |
Request: 393679 | Match: SGN-E393679 |
Request From: SGN database generated link | Match Type: EST sequence internal identifier |
Clone information |
SGN ID: SGN-C183378 | Clone name: TUS-42-A8 |
| ||
Library Name: TUS | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:
Microarray: SGN-C183378 is on microarray TOM1 spot ID 1-1-1.1.2.19 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing |
Clone: SGN-C23171 [cLED-4-K8] | Trace: SGN-T49259 | EST: SGN-E231490 | Direction: 5' | Facility: TIGR |
Clone: SGN-C183378 [TUS-42-A8] | Trace: SGN-T195004 | EST: SGN-E393678 | Direction: 3' | Facility: INRA |
Clone: SGN-C183378 [TUS-42-A8] | Trace: SGN-T196000 | EST: SGN-E394674 | Direction: 5' | Facility: INRA |
Clone: SGN-C183378 [TUS-42-A8] | Trace: SGN-T196000 | EST: SGN-E399214 | Direction: 5' | Facility: INRA |
Clone: SGN-C183378 [TUS-42-A8] | Trace: SGN-T200266 | EST: SGN-E399213 | Direction: 3' | Facility: INRA |
Sequence |
Sequence Id: SGN-E393679 | Length: 109 bp (918 bp untrimmed) |
Status: Current Version | Direction: 5' [See links to 3' reads above] |
>SGN-E393679 [] (trimmed)
CAGATCCTAGCTATACAATGGCAGATTTCATGGAGAAAGCGATGGATTTCGTGTCTGATAAGGTGGAGAAACTGGACCCCCACTTCTCGGATTTT
TATCAGGAAAGAGT
TATCAGGAAAGAGT
Unigenes |
Current Unigene builds | |||||
[SGN-E393679] | SGN-U577990 | Tomato 200607 | Build 2 | 53 ESTs assembled | |
Follow SGN-U# link for detailed information and annotations |
Chromatogram |
SGN-ID: SGN-T195005 [Download][View] | Facility Assigned ID: FA0AAD30BA04RM2 |
Submitter: Koni | Sequencing Facility: INRA |
Quality processing |
Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
Sequence Entropy: 0.871 | Expected Error Rate: 0.0136 | Quality Trim Threshold: 14.5 |