EST details — SGN-E393676
| Search information |
| Request: 393676 | Match: SGN-E393676 |
| Request From: SGN database generated link | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C183372 | Clone name: TUS-42-A2 |
| ||
| Library Name: TUS | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:
Microarray: SGN-C183372 is on microarray TOM1 spot ID 1-1-7.1.2.19 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
| Clone: SGN-C4127 [cLEC-23-K12] | Trace: SGN-T28429 | EST: SGN-E206470 | Direction: 5' | Facility: TIGR |
| Clone: SGN-C183372 [TUS-42-A2] | Trace: SGN-T1757 | EST: SGN-E378616 | Direction: 5' | Facility: Giov. Lab |
| Clone: SGN-C183372 [TUS-42-A2] | Trace: SGN-T195977 | EST: SGN-E394651 | Direction: 3' | Facility: INRA |
| Clone: SGN-C183372 [TUS-42-A2] | Trace: SGN-T195999 | EST: SGN-E394673 | Direction: 5' | Facility: INRA |
| Clone: SGN-C183372 [TUS-42-A2] | Trace: SGN-T195999 | EST: SGN-E399211 | Direction: 5' | Facility: INRA |
| Clone: SGN-C183372 [TUS-42-A2] | Trace: SGN-T200265 | EST: SGN-E399210 | Direction: 3' | Facility: INRA |
| Sequence |
| Sequence Id: SGN-E393676 | Length: 270 bp (866 bp untrimmed) |
| Status: Current Version | Direction: 5' [See links to 3' reads above] |
>SGN-E393676 [] (trimmed)
GCTTTGTATCAAACAACAAGATCTGCAAGTAGCTTAAATTTGCTTCTAACAGATCCATGGCTGAAAATCAAAAAACAGTTTTCAAGTCAGTACAA
GAACTAGCAAATGAAAATCAAGTTCCAGAAAAGTATATTCATACACAAGGGTCAATCAATAGCTCTTGTCCCATGCTGAATGTGCCAGTAGTTGA
CCTTACACTTCTCACATCCACTGCCAGAAAACTTGAGCTCAACAAACTTCAATCAGGCCTCAAGTTTTGTGGCTGCATCC
GAACTAGCAAATGAAAATCAAGTTCCAGAAAAGTATATTCATACACAAGGGTCAATCAATAGCTCTTGTCCCATGCTGAATGTGCCAGTAGTTGA
CCTTACACTTCTCACATCCACTGCCAGAAAACTTGAGCTCAACAAACTTCAATCAGGCCTCAAGTTTTGTGGCTGCATCC
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E393676] | SGN-U563058 | Tomato 200607 | Build 2 | 26 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T195002 [Download][View] | Facility Assigned ID: FA0AAD30BA01RM2 |
| Submitter: Koni | Sequencing Facility: INRA |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.929 | Expected Error Rate: 0.0133 | Quality Trim Threshold: 14.5 |


