EST details — SGN-E393505

Search information 
Request: 393505Match: SGN-E393505
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C182230Clone name: TUS-39-A12
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C182230 is on microarray TOM1 spot ID 1-1-5.1.8.17 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C14404 [cLEC-7-M5] Trace: SGN-T25398 EST: SGN-E202116 Direction: 5' Facility: TIGR
Clone: SGN-C182230 [TUS-39-A12] Trace: SGN-T194765 EST: SGN-E393439 Direction: 3' Facility: INRA
Clone: SGN-C182230 [TUS-39-A12] Trace: SGN-T194765 EST: SGN-E398803 Direction: 3' Facility: INRA
Clone: SGN-C182230 [TUS-39-A12] Trace: SGN-T194830 EST: SGN-E393504 Direction: 3' Facility: INRA
Clone: SGN-C182230 [TUS-39-A12] Trace: SGN-T194831 EST: SGN-E398804 Direction: 5' Facility: INRA
Clone: SGN-C182230 [TUS-39-A12] Trace: SGN-T194832 EST: SGN-E393506 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E393505Length: 490 bp (880 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E393505 [] (trimmed) AAGTTCAATGGACAATAGCCTTGCTATTTTCATTATTTAGATGCTTCCTACATTAGCATAGTAAAAATTACAAAAACACCAACACACACAAAGAA
AAAAGGGAAATAAAGTAGAAATGTAGTGTTTGGCAAATCTAAAATTAAGTGCCAAACATCCAACACAACTCTAACAACATAATTCAAAGAGACTT
TTTTTTCTTCTCAAATACTTATATATACAATTTTCAATTCTTCATGATAATTGTACTAATTAAGCATTGCTCCTGAATGAACCAAGTGCTTTAAC
AGCTCCAGCCCTCAAAATAAACTGATGATAAAATGCAGCAATTGCAGCACCAATAAATGGTCTAACCCAAAATATCCATTGATCATCCCAAGCTT
TGTTATGTCCATAAACAACAGCAGCACCAAAACTCCTTGCAGGATTAATTCCAGTTCCAGTTACAGGAATTGTAGCCAAGTGAACCATAAACACC
GCAAATCCAATGGGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E393505] SGN-U579836 Tomato 200607 Build 2 21 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T194831 [Download][View] Facility Assigned ID: FA0AAD27BA06RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.930 Expected Error Rate: 0.0083 Quality Trim Threshold: 14.5