EST details — SGN-E393289

Search information 
Request: 393289Match: SGN-E393289
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C182182Clone name: TUS-38-O12
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C182182 is on microarray TOM1 spot ID 1-1-5.3.10.14 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C182182 [TUS-38-O12] Trace: SGN-T194826 EST: SGN-E393500 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E393289Length: 105 bp (884 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E393289 [] (trimmed) GTCAAGTGCACTGCATCCTTTTCATCCCTTACCTTCCCTATCGATACTATCTTCTATATCAACTACTTGTCCTATGTTTACAGGGACTGTTTGAT
TTAATTCTTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E393289] SGN-U604296 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T194615 [Download][View] Facility Assigned ID: FA0AAD26BH06RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.871 Expected Error Rate: 0.0268 Quality Trim Threshold: 14.5