Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E393273

Search information 
Request: 393273Match: SGN-E393273
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C182086Clone name: TUS-38-K12
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C182086 is on microarray TOM1 spot ID 1-1-5.3.10.13 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C7783 [cLEC-40-D7] Trace: SGN-T32169 EST: SGN-E210105 Direction: 5' Facility: TIGR
Clone: SGN-C182086 [TUS-38-K12] Trace: SGN-T194600 EST: SGN-E393274 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E393273Length: 342 bp (917 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E393273 [] (trimmed) GTAAACTTGATTGAAATTCGAATTAATCATACACCTAATAAAAAGATGGAAAACAAGGGAAAATGAATACAATTTCTCAAGGGAAAACCCAAAGG
AGAATTCAAACAAACTGTCCCTATAAACATAGGGCAATTAGTTTTTCTAGAACTTAGTATCCTTCGGGCTTGTAAGCGATGAAACTGATGCACTG
CACTTGACGAACATTGTCGAATCCGATGATACGGACCCATGCCTGTGGGTAAGCCTTCTTTGCCTCCTGCACCTCAACCGAAACCTGGGTTGCAT
CGATGCACCCAAACACGTGCAAAATCTACAGAGCCTGATAGGTTTTTTTTTTTTTTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E393273] SGN-U580869 Tomato 200607 Build 2 1124 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T194599 [Download][View] Facility Assigned ID: FA0AAD26BF06FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.935 Expected Error Rate: 0.0081 Quality Trim Threshold: 14.5