EST details — SGN-E393236

Search information 
Request: 393236Match: SGN-E393236
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C181846Clone name: TUS-38-A12
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C181846 is on microarray TOM1 spot ID 1-1-5.1.10.11 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E393236Length: 239 bp (907 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E393236 [] (trimmed) CAGGGAAAATGTAGTCTGCCGCAGACTGTATTGGGAGCTGAAAATGGCCTGATTGTTAGCGATAGCATCATTCAGGGAAGTGATGAAGATGAGAT
TTTATCTGTTGGAGAGGATCCATGTGGAATTAATGGCGAGGAGTTGTTGCCACTGGGCGCTAGCTTGCAGTTGAGCTTGCCAATTGCTGTTGAAA
TTGAGGGTATTGACAATGGACAAATAGGTGGCCGAGGTCATAAGGTTGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E393236] SGN-U584542 Tomato 200607 Build 2 38 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T194562 [Download][View] Facility Assigned ID: FA0AAD26BA06RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.932 Expected Error Rate: 0.0011 Quality Trim Threshold: 14.5