EST details — SGN-E392924

Search information 
Request: 392924Match: SGN-E392924
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C181765Clone name: TUS-37-N3
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C181765 is on microarray TOM1 spot ID 1-1-6.2.12.4 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C148667 [cTOF-8-P14] Trace: SGN-T154943 EST: SGN-E342544 Direction: 5' Facility: TIGR
Clone: SGN-C181765 [TUS-37-N3] Trace: SGN-T194062 EST: SGN-E392736 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E392924Length: 296 bp (860 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E392924 [] (trimmed) ATGCCCGTTGCAGTAAGCAGAAGAGTTCATTACTAAGATTAGGGCCCATTAAACGTAATAAAACTAATACATACCCTTAGTACAAACCATCTCAT
AGATGATTAGAAGTTCAATCTTCTCCGCCTAAGAGACATAAGCCTAATTAGTTTGCTTTGCTCAAATGCACAAATTATTTAGCATTAGCACTATT
TGACAATTGACTATATACCCCTTTTAACTGCAGATGTTTCACCAAATCAATTTCTTTTAGAGACGTCTTTCTCTGGCCTCCGGTAGTCGGGGGGG
GGAGTATCAGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E392924] SGN-U603598 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T194250 [Download][View] Facility Assigned ID: FA0AAD25CG02FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.935 Expected Error Rate: 0.0193 Quality Trim Threshold: 14.5