EST details — SGN-E392727
| Search information |
| Request: 392727 | Match: SGN-E392727 |
| Request From: SGN database generated link | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C181671 | Clone name: TUS-37-J5 |
| ||
| Library Name: TUS | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:
Microarray: SGN-C181671 is on microarray TOM1 spot ID 1-1-4.2.12.3 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
| Clone: SGN-C147185 [cTOF-3-P8] | Trace: SGN-T153292 | EST: SGN-E339968 | Direction: 5' | Facility: TIGR |
| Clone: SGN-C181671 [TUS-37-J5] | Trace: SGN-T194052 | EST: SGN-E392726 | Direction: 3' | Facility: INRA |
| Sequence |
| Sequence Id: SGN-E392727 | Length: 160 bp (839 bp untrimmed) |
| Status: Current Version | Direction: 5' [See links to 3' reads above] |
>SGN-E392727 [] (trimmed)
GCATAATTATAAGTGTATGGCAAGAATATATATGTTTTTGTCACGCTTTATACAAAATTTAAAACACAATATATACACTTCTGTTGTATAAAGTT
AGAGAAAATTGTATTTCACTGCAATTATATAATTCACAATTTTATTATTCGTTGTGCTTTTACTC
AGAGAAAATTGTATTTCACTGCAATTATATAATTCACAATTTTATTATTCGTTGTGCTTTTACTC
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E392727] | SGN-U580684 | Tomato 200607 | Build 2 | 40 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T194053 [Download][View] | Facility Assigned ID: FA0AAD25CE03RM1 |
| Submitter: Koni | Sequencing Facility: INRA |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.847 | Expected Error Rate: 0.0149 | Quality Trim Threshold: 14.5 |
Working
