EST details — SGN-E392448

Search information 
Request: 392448Match: SGN-E392448
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C180406Clone name: TUS-34-E12
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C180406 is on microarray TOM1 spot ID 1-1-5.1.19.9 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C29099 [cLEF-50-C23] Trace: SGN-T62662 EST: SGN-E249154 Direction: 5' Facility: TIGR
Clone: SGN-C180406 [TUS-34-E12] Trace: SGN-T193775 EST: SGN-E392449 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E392448Length: 301 bp (852 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E392448 [] (trimmed) AGGTTAACAGACCTCCATAATGTTATTATTGACTGTTGAAACAACATCCAGATACATTCTTACATCACATTAAGTTGCCTTGCATATAGCCATCA
ATGGTGAGAAACTAAAATGCAAGATATAATACAACAGTGGAAAATAGCCAACATACAACGAATAGAGAGATAATCTGGCTTGTCATCCACTAACA
TTTTCAGCAGACATGTCGTTCTCTTCATCACTTCCTTGACGTATTCTTGCAATTTCTGCCTGAGCTCTCTCCATAATTTGCCTCTTTTGGAGTTC
CAAAATCTCGGTGGAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E392448] SGN-U566395 Tomato 200607 Build 2 8 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T193774 [Download][View] Facility Assigned ID: FA0AAD22BC06FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.948 Expected Error Rate: 0.0035 Quality Trim Threshold: 14.5