Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E392343

Search information 
Request: 392343Match: SGN-E392343
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C180716Clone name: TUS-35-B10
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C180716 is on microarray TOM1 spot ID 1-1-7.2.17.14 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C8021 [cLEC-4-A24] Trace: SGN-T24282 EST: SGN-E201332 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E392343Length: 258 bp (907 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E392343 [] (trimmed) CTCAAAAGAATTAATTATGTGCACAAAAGCCAATTATTATTTCTACCTTTGGCAATTTTTGCTCTTTTTCATCCTAACTCCTAAAATGGATATAA
GGATAACAAATAGTTTTTTATACAAGGAGAATTCCTCCATGCCTTTGCTTGAAATTTGAAAATTTCTCTACCTCTTTCCTTAGCTTTACTTCCAC
ATACAACTTGAAAAATCAACCAAATTTTTGCCTCCACCCCCCAAGACAGCATCTCTTGATGCTCCTTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E392343] SGN-U582344 Tomato 200607 Build 2 22 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T193669 [Download][View] Facility Assigned ID: FA0AAD23DA05FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.853 Expected Error Rate: 0.0131 Quality Trim Threshold: 14.5