EST details — SGN-E391491
Search information |
Request: 391491 | Match: SGN-E391491 |
Request From: SGN database generated link | Match Type: EST sequence internal identifier |
Clone information |
SGN ID: SGN-C186041 | Clone name: TUS-48-P7 |
| ||
Library Name: TUS | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:
Microarray: SGN-C186041 is on microarray TOM1 spot ID 1-1-2.4.7.7 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing |
Clone: SGN-C75451 [cLES-14-C11] | Trace: SGN-T100488 | EST: SGN-E286667 | Direction: 5' | Facility: TIGR |
Clone: SGN-C186041 [TUS-48-P7] | Trace: SGN-T192576 | EST: SGN-E391250 | Direction: 5' | Facility: INRA |
Sequence |
Sequence Id: SGN-E391491 | Length: 131 bp (929 bp untrimmed) |
Status: Current Version | Direction: 3' [See links to 5' reads above] |
>SGN-E391491 [] (trimmed)
CCCCTCCCCCAAACGGAAAAGGAAATTGCACTTTCCCAAAAAAAAAAAATTGACGGGACCGGGACCAAAAAAAAACAGAACCACGGAAAAGCCAA
ATCAAGGAAAAAGGGAAAAGGAAACACAAGGCAAAG
ATCAAGGAAAAAGGGAAAAGGAAACACAAGGCAAAG
Unigenes |
Current Unigene builds | |||||
[SGN-E391491] | SGN-U600848 | Tomato 200607 | Build 2 | 1 ESTs assembled | |
Follow SGN-U# link for detailed information and annotations |
Chromatogram |
SGN-ID: SGN-T192817 [Download][View] | Facility Assigned ID: FA0AAD36CH04FM1 |
Submitter: Koni | Sequencing Facility: INRA |
Quality processing |
Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
Sequence Entropy: 0.935 | Expected Error Rate: 1.0000 | Quality Trim Threshold: 14.5 |