EST details — SGN-E391408

Search information 
Request: 391408Match: SGN-E391408
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C185796Clone name: TUS-48-F2
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C185796 is on microarray TOM1 spot ID 1-1-7.2.7.5 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C185796 [TUS-48-F2] Trace: SGN-T192393 EST: SGN-E391067 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E391408Length: 332 bp (909 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E391408 [] (trimmed) AGGTACTTTGGAACGTTCAACTTCACCGAGCCGGTCTATTGCTGCGGTGAACCGGAACCACGTGGTGCAGAATCGGAGTCAGAAGAAGTCGTGTA
TGTGCTCACCGACGACACATCCAGGTTCGTTCCGATGTAGTCTACATAAGAATAAAAGTGGTTCAGGTTCAACTGGTAGAGGTACCTGCCCGGCC
GATGGTCCGCATGTCAATGGTCCTCCTGCCGATGGTCCCTGTGACAGACTTACTGTTGGTCCGTCCGCCGCCGGTGCCATATCGCTTCTAGATGG
TCCGTCTGCCGACTGTGCAATACGGCTTCGTGACGATGGTCCGCCTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E391408] SGN-U590621 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T192734 [Download][View] Facility Assigned ID: FA0AAD36DC01FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: Multiple cloning site sequence detected -- chimeric clone suspected.
Passed all screens and filters
Sequence Entropy: 0.988 Expected Error Rate: 1.0000 Quality Trim Threshold: 14.5