EST details — SGN-E391321

Search information 
Request: 391321Match: SGN-E391321
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C185322Clone name: TUS-47-B8
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C185322 is on microarray TOM1 spot ID 1-1-1.2.10.19 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C73465 [cLER-4-O7] Trace: SGN-T92907 EST: SGN-E278074 Direction: 5' Facility: TIGR
Clone: SGN-C185322 [TUS-47-B8] Trace: SGN-T192453 EST: SGN-E391127 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E391321Length: 529 bp (903 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E391321 [] (trimmed) AAGATGAAAACGTTCAATGATGTACTCACAAGAAATTCATTCTAGATTATCAAGATAATACAAGGGAGTGTGTCCTCTATGCAGGAAACTGTTAC
TTGAATACACTATATAACTTACAACAATGAACATGCACCTCTATGTGAAAACAACCGAGATTCTGTTTCTCGTGACAAGGAAATTAGTAGGTAAG
TTGTGGTTCAAACTCAGCAAAATCAACCGAACCTGACTCAATAGGTTTCATGAAATACGCAGCCAATAACTCAAAAGCCAAAGCTGCAATCAGAG
GGATCTTTTTGAAATTCTTCACCAGTGGAATCTCATCACTCTCACTAACAGCAATTAGTTTGGTGTTAATCTCCACCATCCTGTCCAACTTCCTC
TTGAATTCTGGGTTCTCAACATCAAGGACAGCAGGGAAAATCCTTGCAGTTGTGCGGTTTGTCTCAATGATGACATGCATGTCAAATTCTTTGGT
GTTAAGCCCAATGCCTTCGTAAAAATCTGTTCTTTGGCAATCATTCAAGTACAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E391321] SGN-U574472 Tomato 200607 Build 2 157 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T192647 [Download][View] Facility Assigned ID: FA0AAD35DA04FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.954 Expected Error Rate: 0.0051 Quality Trim Threshold: 14.5