EST details — SGN-E390973

Search information 
Request: 390973Match: SGN-E390973
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C185351Clone name: TUS-47-C13
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C185351 is on microarray TOM1 spot ID 1-1-4.3.9.2 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C69667 [cLER-12-D4] Trace: SGN-T94518 EST: SGN-E283551 Direction: 5' Facility: TIGR
Clone: SGN-C185351 [TUS-47-C13] Trace: SGN-T192056 EST: SGN-E390730 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E390973Length: 225 bp (878 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E390973 [] (trimmed) CCCTTTTGTTCAAGCAAGATAGATGATAGCATAAATGGTACCCCTTAAAACTCCAAAGTACTTGGAAAACTAGCACAACTGACTAGATCAATCTA
CTAAATCACTCTTGTATGCACCTGCTAATAATCTATTAATAAAAAAAAGCTCATACTCTCAAATTAGCCCATTCTAATATCCAAATTTACCCAAA
CAACAGTGGAAAAATACAAATGGTAAGCGAAGTTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E390973] SGN-U589314 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T192299 [Download][View] Facility Assigned ID: FA0AAD35AB07FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read -- flanking 5' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.925 Expected Error Rate: 0.0129 Quality Trim Threshold: 12.5