EST details — SGN-E390881

Search information 
Request: 390881Match: SGN-E390881
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C185598Clone name: TUS-47-M20
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C185598 is on microarray TOM1 spot ID 1-1-5.1.9.9 [Order] [Tomato Microarray Database]
See unigene SGN-U581507 for alternative clones/ESTs which are mapped
Additional sequencing 
Clone: SGN-C3127 [cLEC-19-L14] Trace: SGN-T27543 EST: SGN-E202702 Direction: 5' Facility: TIGR
Clone: SGN-C185598 [TUS-47-M20] Trace: SGN-T191973 EST: SGN-E390647 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E390881Length: 564 bp (886 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E390881 [] (trimmed) ATAACAAAAGATCAAAATCATATAACTTTAGTATTTCTGAAAATAAACTTCCATTTTTCTAAATGGGCATACAGAATCCCCTTATTGATTACATC
CAAATATAACTTATAGACTTCACAACGTAATACATAAACATAATTTGCATTCTCTCTCTATATATAAATAAAGACGCTTAGCCCTGGGCGAAGTT
CTTTTGATTGTTACAGTCCAAATTTTCACCAGTAGGAACATTCAACATACCACAATACCTCCTGTAAAATCCAATTCGACTTTCCGCTGCAGTAT
TCGGACCCATCCCACATTCAAATTGACCGTTAATGATGTTGGTAATGACACCGTACCCTGGAACTCTATTAGCTGCTGTATCTTTAGGGGATGGC
GTCCATTGTCCAATGATAACGTTGTGGCATGATGGTTTATTATCCTGTTCTGTCATCCAGAACCATATTGCTGTTTTGAATGATATTATAGGATC
TGTCGCAACTAAAATCAGGGTTGTTCACTAACTCTTGTCCAACACCCATACCTTTGTCCCGCTCGTTCGTAGTTAGATTGGGTGTGTCA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E390881] SGN-U581507 Tomato 200607 Build 2 59 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T192207 [Download][View] Facility Assigned ID: FA0AAD35BG10FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.952 Expected Error Rate: 0.0058 Quality Trim Threshold: 14.5