Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E390869

Search information 
Request: 390869Match: SGN-E390869
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C185532Clone name: TUS-47-K2
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C185532 is on microarray TOM1 spot ID 1-1-7.3.10.21 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C75516 [cLES-14-G15] Trace: SGN-T100499 EST: SGN-E286678 Direction: 5' Facility: TIGR
Clone: SGN-C185532 [TUS-47-K2] Trace: SGN-T197606 EST: SGN-E396280 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E390869Length: 297 bp (858 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E390869 [] (trimmed) GGAATAGAAAAATCCATTATATTGTCAACTCATTCACAACAACTTTACATGAAAATTTGAAAATCATTTTATGATATTCACTTTCCGGGAACAAA
GTTTGTGGCGAAGGCCCAGGCGTTGTTGTTTACTGGGTCTGCAAGGTGATCAGCAAGGTTCTCCAATGGACCTTTTCCGGTAACAATGGCTTGAA
CAAAGAATCCAAACATAGAGAACATAGCAAGTCTACCGTTCTTGATCTCCTTTACCTTGAGCTCAGCAAATGCCTCGGGGTCTTCAGCAAGGCCT
AATGGGTCGAAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E390869] SGN-U578708 Tomato 200607 Build 2 218 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T192195 [Download][View] Facility Assigned ID: FA0AAD35BF01FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read -- flanking 5' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.963 Expected Error Rate: 0.0022 Quality Trim Threshold: 12.5