EST details — SGN-E390527

Search information 
Request: 390527Match: SGN-E390527
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C182733Clone name: TUS-40-F11
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C182733 is on microarray TOM1 spot ID 1-1-6.2.5.3 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C130664 [cTOD-1-C7] Trace: SGN-T141718 EST: SGN-E326008 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E390527Length: 378 bp (892 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E390527 [] (trimmed) GCCAACATGTATTTTACATTAACTAACTAGATTTAAAACAAATATCGGACACATATTAAAAAATTAATTTGAAAAAATGATTTTTCAATTTCAGT
TTTCATTTTAAAAGTGAAATTCCATTTTTACCCTTTTTCACCTACTATTTAATTTTCATTTTCTTTTAGAATTTTCTAGTTATGGTGTTTTCCTT
CTTCCTTCCTTCTTTTTAGTATAACAAGATTAATGGAGTCAACAATTTACAGACGAAACATCTGCTCAAAAAACCAACCAGAAAGGCTCAAGCTA
CGACGTTTTTGAGCTGATGGATGAAGAATTCGAGAGGAAGAGGATTGAAGTTAAAGGCTATGGAAGCTTTGGGCTGTGGGTTTGATTTTGCAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E390527] SGN-U569159 Tomato 200607 Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T191853 [Download][View] Facility Assigned ID: FA0AAD28CC06RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.922 Expected Error Rate: 0.0017 Quality Trim Threshold: 14.5