EST details — SGN-E390396

Search information 
Request: 390396Match: SGN-E390396
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C183289Clone name: TUS-41-M15
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C183289 is on microarray TOM1 spot ID 1-1-2.1.3.11 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C93939 [cLEX-1-I23] Trace: SGN-T115127 EST: SGN-E302544 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E390396Length: 382 bp (884 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E390396 [] (trimmed) CACGAGACAACATGATTTTGGAATACCAATGAAAAATATATATGCAGATGAAGAAAAATTACTATAAGAGAATGGACTTAACTCAAGTGTAGTTG
CATTTGTAGAAAAGATCATTCTCTATTTAATTTTTTTTTTGTCCCTATTATATCTTATATTTTGTTTCCATTTTCTCATCATATAATTAAGTTAA
GTGTGGCATGATTGTGAAGTGTAGGAGAGCTTAAAAGGGCCAAAGTCTTATTCATTGCAACTTCTTCTCTTCATGTTTTTGGCCCTCTTATCTCC
AAATTGTATGTTGGTTGCTTTAGCTCAGATAGAGCCAGCAATATCTTGTTTCTATTGGAAAAAAAAATATAACATGGTGATTTAAATTTTGTTTT
AG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E390396] SGN-U581270 Tomato 200607 Build 2 79 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T191722 [Download][View] Facility Assigned ID: FA0AAD29AG08RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.916 Expected Error Rate: 0.0079 Quality Trim Threshold: 14.5