EST details — SGN-E390243

Search information 
Request: 390243Match: SGN-E390243
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C182655Clone name: TUS-40-C5
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C182655 is on microarray TOM1 spot ID 1-1-4.3.6.19 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C117493 [cTOA-8-G8] Trace: SGN-T125041 EST: SGN-E312852 Direction: 5' Facility: TIGR
Clone: SGN-C182655 [TUS-40-C5] Trace: SGN-T191792 EST: SGN-E390466 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E390243Length: 587 bp (879 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E390243 [] (trimmed) GTTCATTAGTTATATTTAACTTTTTTAGCTAGATTTTTCTATTAGTAATTATTTGCTAGTGATTTTGATAATATATGTTTTTATTTTATCTTTTT
TCTTTTTTAAAAAAATAAATAAATCTTAGTGTATTGATTTAGCTTGTTTCTTACCAATTATATTTTTAGATATATTTTTCTATTATTTATTTGCT
AGTGATATTGAAAATATATATGTTTCTATGAGTTTTAGTTTTAGTTTTTATTTTTAATAAAAAAAATCATTTCTTAGTGTATTGATTTAGCTTGC
TTCTTCAATTAAAAGATTGTGTTCAAGTTATATATGATGAAACTTTTGAACAAATCCAATCTACACATAAAGTTTTTTCAAAAAAAATATTTTTT
TTTGTTTTGAAGTCTTAGATAGTGTATATTCTTCTTAATTTAGATCTTACTATTGTATCTAAGAATATGTATATATATGTACTTGGATTTGTACC
CTATAAATATATATCCTATTTGAAGCATTTATTTAATTTAGGGTTTGTGGTCCATTTTTTTAGATATTCAATAATATTGAAACGATACCGAGAAA
ATAAAATTTTTGAATTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E390243] SGN-U564654 Tomato 200607 Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T191569 [Download][View] Facility Assigned ID: FA0AAD28AB03RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.836 Expected Error Rate: 0.0039 Quality Trim Threshold: 14.5