Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E390118

Search information 
Request: 390118Match: SGN-E390118
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C174011Clone name: TUS-17-K1
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C174011 is on microarray TOM1 spot ID 1-1-8.3.18.21 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C6570 [cLEC-35-N16] Trace: SGN-T30920 EST: SGN-E210572 Direction: 5' Facility: TIGR
Clone: SGN-C174011 [TUS-17-K1] Trace: SGN-T191443 EST: SGN-E390117 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E390118Length: 302 bp (873 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E390118 [] (trimmed) CTTCGACCCATTAGGCCTTGCTGAAGACCCCGAGGCATTTGCTGAACTCAAGGTAAAGGAGATCAAGAACGGTAGACTTGCTATGTTCTCTATGT
TTGGATTCTTTGTTCAAGCCATTGTTACCGGAAAAGGTCCATTGGAAAACCTTGCTGATCACCTTGCAGACCCAGTAAACAACAACGCCTAGGGC
CTTCGCCACAAACTTTGTTCCCGGAAAGTGAATATCATAAAATGATTTTCAAATTTTCATGTAAAGTTGTTGTGAATGAGTTGACAATATAATGG
ATTTTTCTATTCCAATG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E390118] SGN-U578708 Tomato 200607 Build 2 218 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T191444 [Download][View] Facility Assigned ID: FA0AAD5AF01RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.954 Expected Error Rate: 0.0071 Quality Trim Threshold: 12.5