EST details — SGN-E379647

Search information 
Request: 379647Match: SGN-E379647
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C167899Clone name: TUS-1-L9
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C167899 [TUS-1-L9] Trace: SGN-T44 EST: SGN-E379838 Direction: 5' Facility: Avesthagen
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E379647Length: 250 bp (816 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E379647 [] (trimmed) TTTTTGGTGGTATAGTTTCTTTGAACTTGCATTGTTTATTTATTAATTATCAAAAATAAAGTTTATTGAGGGGAGAGAAGAGAAAAAAGAAATGG
ACATAAAGGAAGATTTTTGAAGGAATAAATGAAGGGACAAAGTTTGTACATTTTTTTATTAAAAAAAAAAACTCTTTTTTTTTCTTTTATTTCCT
TTTTGTTCATGGGTGTAAATGTGAGCAATCTGGTTAAGTAGAATTCCATTTCCTTCCCTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E379647] SGN-U599190 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T518 [Download][View] Facility Assigned ID: 231_D09_TUS01L9.Td_073.ab1
Submitter: Koni Sequencing Facility: Avesthagen
Funding Organization: Italian Ministry of Agriculture and Forestry (MiPAF)
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.846 Expected Error Rate: 0.0182 Quality Trim Threshold: 14.5