EST details — SGN-E378819

Search information 
Request: 378819Match: SGN-E378819
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C185897Clone name: TUS-48-J7
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C185897 is on microarray TOM1 spot ID 1-1-2.2.7.6 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C17129 [cLED-18-L3] Trace: SGN-T53294 EST: SGN-E237991 Direction: 5' Facility: TIGR
Clone: SGN-C185897 [TUS-48-J7] Trace: SGN-T192549 EST: SGN-E391223 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E378819Length: 118 bp (1113 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E378819 [] (trimmed) AAGTCGTCTGACTCTCTATCCAGCCAATGTCGCTGACATTGAGCCAGAGGTGAAGCAGATGGTTACCGTCTCCGGTCGTATCCGTGCGGAAGACG
GCACACTGCTGGCTAACGCACGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E378819] SGN-U575025 Tomato 200607 Build 2 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T1912 [Download][View] Facility Assigned ID: TUS48J7.ab1
Submitter: Koni Sequencing Facility: Giov. Lab
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: Multiple cloning site sequence detected -- chimeric clone suspected.
Passed all screens and filters
Sequence Entropy: 0.000 Expected Error Rate: 0.0000 Quality Trim Threshold: 0