EST details — SGN-E378818
| Search information |
| Request: 378818 | Match: SGN-E378818 |
| Request From: SGN database generated link | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C185842 | Clone name: TUS-48-G24 |
| ||
| Library Name: TUS | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:
Microarray: SGN-C185842 is on microarray TOM1 spot ID 1-1-1.3.7.13 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
| Clone: SGN-C185842 [TUS-48-G24] | Trace: SGN-T188424 | EST: SGN-E376384 | Direction: 3' | Facility: INRA |
| Sequence |
| Sequence Id: SGN-E378818 | Length: 167 bp (1172 bp untrimmed) |
| Status: Current Version | Direction: 5' [See links to 3' reads above] |
>SGN-E378818 [] (trimmed)
AAAAAAAAGGGCCTTTTATCACAAAGTTCGGGGGGGCCCCCCAAAAGAAAATTTCCTCCGTTTTCCCCAAAAAAAAATTTTGGGGGGGTTTCAAA
AACCCCCCCCCAAAAAAAAGGGGGGCGGTTTTCCTTTAAAAAATAAAAAATGGGCTTTTTATTCCCCTCCGG
AACCCCCCCCCAAAAAAAAGGGGGGCGGTTTTCCTTTAAAAAATAAAAAATGGGCTTTTTATTCCCCTCCGG
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E378818] | SGN-U603830 | Tomato 200607 | Build 2 | 1 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T1904 [Download][View] | Facility Assigned ID: TUS48G24.ab1 |
| Submitter: Koni | Sequencing Facility: Giov. Lab |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.613 | Expected Error Rate: 0.0149 | Quality Trim Threshold: 20.5 |
Working
