Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E378726

Search information 
Request: 378726Match: SGN-E378726
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C183879Clone name: TUS-43-F5
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C183879 is on microarray TOM1 spot ID 1-1-4.2.19.17 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C4502 [cLEC-27-A17] Trace: SGN-T28801 EST: SGN-E204067 Direction: 5' Facility: TIGR
Clone: SGN-C183879 [TUS-43-F5] Trace: SGN-T199932 EST: SGN-E398606 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E378726Length: 320 bp (1131 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E378726 [] (trimmed) TCTCTCATTCTCCGGCGACCTCTCTTCTTCTCTTCCCATCTCTGCTCCGTCGTTTTTCCTCCAACACTTCGGTATCTCTCACGCGACACAAACAC
AAATCATCTTCTCTACCTCCTCCTCCTCCTCCTCCGCCGCCGCCGTCGTCTTCTTCTTCTCTTCTCCGACCGTCGGCGACTCTATCCGAAGCCCT
GGCGCAGAAAATTGGAAAATCTATTCGCCGTCCCGGCGCACCTTCAAAGGCCCGGGTGTATACGGATATCAATGTGATCCGACCTNAAGAGTATT
GGGATTATGAATCCCTAACTGTTCATGGGGGGGAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E378726] SGN-U581223 Tomato 200607 Build 2 25 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T1789 [Download][View] Facility Assigned ID: TUS43F5.ab1
Submitter: Koni Sequencing Facility: Giov. Lab
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.937 Expected Error Rate: 0.0127 Quality Trim Threshold: 14.5