EST details — SGN-E378647

Search information 
Request: 378647Match: SGN-E378647
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C185250Clone name: TUS-46-O8
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C185250 is on microarray TOM1 spot ID 1-1-1.3.12.16 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C46076 [cLEI-11-C24] Trace: SGN-T81983 EST: SGN-E265828 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E378647Length: 312 bp (1087 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E378647 [] (trimmed) TATGGCACCCCTAAGGTGGTTAACTTCGGAGTTACAATTGCTCGTGCCATCGAGCTACCTGATGCTATGGAGAATGCTGGGGCTGCCCTTATCAG
GGAGGTTGCAAGCAAAACCAATGATTCAGCTGGTGATGGAACAACAACTGCATCTGTTCTTGCTCGGGAAATCATTAAACTCGGTCTGTTGAGTG
TTACATCTGGTGCAAATCAGTGTCTTTAAAGAGGGGCATTGACAAACTGTACTGGGTTTGATGAAGAGCTAGAAAAGAAGCTAGACCTGTTAAAG
GCCTGAGACATCAAAGTATTGCTCAAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E378647] SGN-U579512 Tomato 200607 Build 2 185 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T1885 [Download][View] Facility Assigned ID: TUS46O8.ab1
Submitter: Koni Sequencing Facility: Giov. Lab
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.970 Expected Error Rate: 0.0090 Quality Trim Threshold: 20.5