EST details — SGN-E378604

Search information 
Request: 378604Match: SGN-E378604
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C182457Clone name: TUS-39-J23
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C182457 is on microarray TOM1 spot ID 1-1-2.2.7.2 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E378604Length: 357 bp (1233 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E378604 [] (trimmed) CCTGCAGGTTAGGGACTATAAATCCCTCCCTACCAACCACACCCTCCGTAGGCTACGTATCAATGCTTCGAAGTCCAGCCCAAGAGTCACCGGCA
GAAACCTTCGCGTTGCGGTGATTGGTGGTGGTCCTGCTGGTGGCGCCGCTGCAGAGACGCTCGCTAAGGGTGGAATTGAGACCTTTTTGATAGAA
CGCAAGATGGACAACTGCAAACCCTGCGGTGGTGCCATCCCACTCTGCATGGTGGGCGAATTCGATCTACCTCTCGATATCATCGATCGGAAAGT
TACCAAGATGAAGATGATTTCCCCATCCAACGTCGCCGTCGATATCGGACAGACTCTGAAGCCTCACGAGTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E378604] SGN-U564570 Tomato 200607 Build 2 46 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T1722 [Download][View] Facility Assigned ID: TUS39J23.ab1
Submitter: Koni Sequencing Facility: Giov. Lab
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.984 Expected Error Rate: 0.0031 Quality Trim Threshold: 14.5