Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E378231

Search information 
Request: 378231Match: SGN-E378231
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C184829Clone name: TUS-45-M19
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C184829 is on microarray TOM1 spot ID 1-1-6.1.14.18 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C81431 [cLET-16-G22] Trace: SGN-T106687 EST: SGN-E292554 Direction: 5' Facility: TIGR
Clone: SGN-C184829 [TUS-45-M19] Trace: SGN-T198513 EST: SGN-E397187 Direction: 5' Facility: INRA
Clone: SGN-C184829 [TUS-45-M19] Trace: SGN-T200026 EST: SGN-E398700 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E378231Length: 307 bp (1084 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E378231 [] (trimmed) TAAACTATTTCTCTTTCATTCCTTCCTCACTTTTCTTTGCTTTTGGGTTTCTGGTTTATTTTTTCTCTTCTAGTTTTGTTTTGGTTTGATCTGCT
TCGTGGGGTTCTTTATATTCTCTTGAAATCTTGAATTTTGGGTGTTTCTTGAAAATTCAAAGAGATGGAGAGGGACTTTATGGGATTGAATATCA
AAGATTCTTTACTTGTAGTCAAGGATGAACCTGTTGAAAGCTCAAAGACTCTGGGTTTCGCTGGCCATGTCGAGCAGGGTGGTGTACCTCATTCA
TGTCTTTGACTCTGCTCAGATG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E378231] SGN-U564449 Tomato 200607 Build 2 121 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T1847 [Download][View] Facility Assigned ID: TUS45M19.ab1
Submitter: Koni Sequencing Facility: Giov. Lab
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.883 Expected Error Rate: 0.0061 Quality Trim Threshold: 20.5