EST details — SGN-E378221

Search information 
Request: 378221Match: SGN-E378221
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C183934Clone name: TUS-43-H12
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C183934 is on microarray TOM1 spot ID 1-1-5.4.19.21 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C7715 [cLEC-39-P4] Trace: SGN-T31884 EST: SGN-E208594 Direction: 5' Facility: TIGR
Clone: SGN-C183934 [TUS-43-H12] Trace: SGN-T198108 EST: SGN-E396782 Direction: 3' Facility: INRA
Clone: SGN-C183934 [TUS-43-H12] Trace: SGN-T199923 EST: SGN-E398597 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E378221Length: 291 bp (1150 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E378221 [] (trimmed) TATTATAACTATACTTCTGGTTACATCCACCACTGCAATATCAAAAATTTGAATTTCCCTACCAAATACTACTATAAGATTGGGATTGGACATAT
ATCACGAACCTTCTGGTTCACAACTCCTCCAGAAGTCGGCCCTGATGTACCCTATACATTTGGTCTTATAGGGGATCTTGGTCAGAGTTTTGATT
CAAACAAGACACTCACACATTATGAATTAAATCCCAATTAAGGGGCAGCAGTGTTGTTCGTAGGTGACTTATCTTATGCTGATAACTACCCTAAT
CATGAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E378221] SGN-U576865 Tomato 200607 Build 2 15 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T1794 [Download][View] Facility Assigned ID: TUS43H12.ab1
Submitter: Koni Sequencing Facility: Giov. Lab
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.927 Expected Error Rate: 0.0061 Quality Trim Threshold: 20.5