EST details — SGN-E378078

Search information 
Request: 378078Match: SGN-E378078
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C175682Clone name: TUS-21-P16
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C175682 is on microarray TOM1 spot ID 1-1-1.4.13.17 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C15747 [cLED-13-N14] Trace: SGN-T51774 EST: SGN-E236496 Direction: 5' Facility: TIGR
Clone: SGN-C175682 [TUS-21-P16] Trace: SGN-T190693 EST: SGN-E378079 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E378078Length: 477 bp (921 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E378078 [] (trimmed) GGGGGAATTACTCTTTCCAATCGATATTATTTGTCTTATAAAGTTTTGAATCAACTAATAACATATTTAAATTCCAATAAACAACAGCATAATAC
AATAATCATGGGCTCCTATACATCTAAATTGTACTCACTAAACTGTTATTAAATCTAATCAAACTCAATAATACATTGAAAACTACACTTGCCTT
GTTGCAAAATAAAAACAAAGTAGAACCATTTTTCCAGCATATTAGGGTAAAAAGAGAGTTTATTTACTTTCCTTTTCCATTTAACTTCACCTATT
ACTATTTGTACACAAGACTATTTCATGTTGTTCCATTTGAATATTGCAGCTGCTTACTTGTACACGAGCATTTCGCCTTTTTATCGGTCAGTGTC
TGGACTTGTTTCTGAAGGGCTTTAATGTAATCAACTGCCAAATCTAACATATCAGCTGTGTTTGTTTGCTTGTCCATTTTTGGGAAAAGATCTTG
CA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E378078] SGN-U564763 Tomato 200607 Build 2 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T190692 [Download][View] Facility Assigned ID: FA0AAD9DH08FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.916 Expected Error Rate: 0.0136 Quality Trim Threshold: 14.5