EST details — SGN-E377851

Search information 
Request: 377851Match: SGN-E377851
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C175585Clone name: TUS-21-L15
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C175585 is on microarray TOM1 spot ID 1-1-2.4.13.16 [Order] [Tomato Microarray Database]
See unigene SGN-U582213 for alternative clones/ESTs which are mapped
Additional sequencing 
Clone: SGN-C15537 [cLED-13-D22] Trace: SGN-T51905 EST: SGN-E236627 Direction: 5' Facility: TIGR
Clone: SGN-C175585 [TUS-21-L15] Trace: SGN-T190612 EST: SGN-E377850 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E377851Length: 548 bp (926 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E377851 [] (trimmed) AGAAGTAACAGATTTAGTAGTAATTATAATTGGCATCACACAATTGGAGTTAAAATATGTGAATCTAATGACGGTTTACGCTAAAACTGTAAAGT
AAGCGCTTCTCGAAATGCATTACAATAGCAGCAAAACAATTGTAACTAAAACTATCTATACTAGCATTTCTTTCAATGGTCGCTACATACTTGGT
GAAAAGCGCTTAGCATATGCCAATGAAAGGTGAAAGAAATAAAGAATAAAGAGGACTCTCGACATATTTGAAAGCAGATCATCATTTTCACTTTG
ATTTCAGAGTTTGAAGATCAGTTTCGTTTAGAAACGAAGGCATAACTTTAATTGGTTGAAAAGTGAAACCAGCTTTGTGGCATGCGTCCTCCAGC
TGCTTCACTTGTGAAGTTCCATCCGGACAGTACACAACCACAGCCCCACCACTTCCTGTGAACTTGGAAGCAGCACCTACCTTTCGAGCGATTTC
AACCATCTCTATATTCATAGCTCCAAGGGCATTATCTCCAAACATACGCCTTCTCAAGTCAAAATTGTGATTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E377851] SGN-U582213 Tomato 200607 Build 2 26 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T190613 [Download][View] Facility Assigned ID: FA0AAD9CF08RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.962 Expected Error Rate: 0.0033 Quality Trim Threshold: 12.5