Notice: the solgenomics has been unstable, we apologize for the inconvenience.

EST details — SGN-E377477

Search information 
Request: 377477Match: SGN-E377477
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C175097Clone name: TUS-20-H7
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C175097 is on microarray TOM1 spot ID 1-1-2.4.14.20 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C23948 [cLED-6-M19] Trace: SGN-T49937 EST: SGN-E232951 Direction: 5' Facility: TIGR
Clone: SGN-C175097 [TUS-20-H7] Trace: SGN-T1345 EST: SGN-E378256 Direction: 5' Facility: Giov. Lab
Clone: SGN-C175097 [TUS-20-H7] Trace: SGN-T189975 EST: SGN-E377476 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E377477Length: 691 bp (877 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E377477 [] (trimmed) ACAAATTATAAGAGGCTGAAATGAATATATTATCGCTGTCAGCCTATTATTGCAGTGAGTTTTTTCCTTCTTTGATGATTCCGATTATCTCCCAC
TAATCCATTTCCCCGATTCAACCAATCCCAAACCTTACGGGAAATAGTTGTGTCTTGATTGATTCATGACTAACTCTTTTAGGAAGAAGTATGAA
GTCTTTTTTCCCCCTCTATTTTATTATGTTTTTCAATACTATCCTCAGCCAAAAGCAACAATAACAATTACGCCTCAATCCGAAACAGGTATTTT
CAACCAAGATACACGATTTAAACTTGTTTATGACATGCTGTCCAACTGTGAAATGCTTCATAGAGAGCGGTGGCGGAAAACATGTACATGTGATA
TAATTTGTTGAGGTTACACTCCCATCACAGTGCTACTGTAATCCATATATATTGTTGGCGGCTATCCCGTGAAGTTTAGAACTTCTTGCTCTTCA
GGTTTCTTTTTTCACTTTCTTACCTTTCTCATGTCATGGACAACGTAGTTCAAATGTCGAAATTTTGTTGATTTTGATTATTGAGTTTTTTTGTT
CTACTATTATCTAGTCAGTGACAAGACAGTAAAAATTAGAGCTTTTCAAGTTGTGAAAATGTTGTTTTTTCTTAACAAAGTGATGTACTTTTGTT
TGACTGCTTATGCTGANGTATCGCGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E377477] SGN-U584124 Tomato 200607 Build 2 12 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T189976 [Download][View] Facility Assigned ID: FA0AAD8CD04RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.945 Expected Error Rate: 0.0028 Quality Trim Threshold: 14.5