EST details — SGN-E377387
| Search information |
| Request: 377387 | Match: SGN-E377387 |
| Request From: SGN database generated link | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C175318 | Clone name: TUS-21-A12 |
| ||
| Library Name: TUS | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:
Microarray: SGN-C175318 is on microarray TOM1 spot ID 1-1-5.1.13.14 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
| Clone: SGN-C24280 [cLED-7-L20] | Trace: SGN-T50447 | EST: SGN-E231938 | Direction: 5' | Facility: TIGR |
| Clone: SGN-C175318 [TUS-21-A12] | Trace: SGN-T190438 | EST: SGN-E377388 | Direction: 5' | Facility: INRA |
| Sequence |
| Sequence Id: SGN-E377387 | Length: 218 bp (948 bp untrimmed) |
| Status: Current Version | Direction: 3' [See links to 5' reads above] |
>SGN-E377387 [] (trimmed)
GGAGTGAAAAGAAGTGAAATTAATCCGTAAAAAATCTTCAATGACTGAGCTCAACATGATTATTACAACTAGAACAAAATCAGCAAGGCATCTCT
GGATTCAACTGCCTAGTCGCAGTATCAAATTAAACATAAAAGTTCCAACGCTAGATGTTCTAATCTTGTATAGGGGGGGTGGTACATAATTTAAA
ATAAATAGGTTAATTGCACCACATCTAA
GGATTCAACTGCCTAGTCGCAGTATCAAATTAAACATAAAAGTTCCAACGCTAGATGTTCTAATCTTGTATAGGGGGGGTGGTACATAATTTAAA
ATAAATAGGTTAATTGCACCACATCTAA
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E377387] | SGN-U580117 | Tomato 200607 | Build 2 | 26 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T190437 [Download][View] | Facility Assigned ID: FA0AAD9BA06FM1 |
| Submitter: Koni | Sequencing Facility: INRA |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.914 | Expected Error Rate: 0.0026 | Quality Trim Threshold: 14.5 |


