EST details — SGN-E377087

Search information 
Request: 377087Match: SGN-E377087
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C175513Clone name: TUS-21-I15
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C175513 is on microarray TOM1 spot ID 1-1-2.1.13.16 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C15394 [cLED-11-M7] Trace: SGN-T51475 EST: SGN-E235465 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E377087Length: 358 bp (963 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E377087 [] (trimmed) GGACAGCAGCATTGAAAGAAAATATATTAGAGAGGTTTTCTTTTGGGTTTTGATTTTTTTTGGATAAAATCGAAAAAGGGAAAAGAGAGGAGAAT
TTCTTCGGGGAGAGACGTGGAAATAGCGGAAAGAGTGGCTTTTTGTTATTCTATAGGAGTTTTGAGTAAGAAATATTAAGAGTTGGCTTAAGAAA
ATAACTAAGATAATATATAGAGATTCACGTCTAAGGTGGAGGGGTTGGATATTCGATAAAGTTATTTCCCTGCTCGTCTCACTAGTCCGTGTTCA
AAATCGGAAGTTTTGGCTTAGCTTCTGTTGTCGTAGTTCGGTTTGGTGTGACGTTGCTCTCAAGCTCGTTTTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E377087] SGN-U584587 Tomato 200607 Build 2 32 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T190278 [Download][View] Facility Assigned ID: FA0AAD9AE08RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.928 Expected Error Rate: 0.0068 Quality Trim Threshold: 14.5