EST details — SGN-E376991

Search information 
Request: 376991Match: SGN-E376991
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C174987Clone name: TUS-20-C17
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C174987 is on microarray TOM1 spot ID 1-1-8.3.13.6 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C23824 [cLED-6-H13] Trace: SGN-T50067 EST: SGN-E233081 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E376991Length: 234 bp (921 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E376991 [] (trimmed) GGACAGCAGCATTGAAAGAAAATATATTAGAGAGGTTTTCTTTTGTGTTTTGATTTTTTTTGGATAAAATCGAAAAAGGGAAAAGAGAGGAGAAT
TTCTTCGGGGAGAGACGTGGAAATAGCGGAAAGAGTGGCTTTTTGTTATTCTATAGGAGTTTTGAGTAAGAAATATTAAGAGTTGGCTTAAGAAA
ATAACTAACATAATATATAGAGATTCACGTCTAAGGTGGAGGGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E376991] SGN-U584587 Tomato 200607 Build 2 32 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T189746 [Download][View] Facility Assigned ID: FA0AAD8AB09RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.888 Expected Error Rate: 0.0053 Quality Trim Threshold: 14.5