EST details — SGN-E376420
Search information |
Request: 376420 | Match: SGN-E376420 |
Request From: SGN database generated link | Match Type: EST sequence internal identifier |
Clone information |
SGN ID: SGN-C186024 | Clone name: TUS-48-O14 |
| ||
Library Name: TUS | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:
Microarray: SGN-C186024 is on microarray TOM1 spot ID 1-1-3.3.7.11 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing |
Clone: SGN-C186024 [TUS-48-O14] | Trace: SGN-T188461 | EST: SGN-E376421 | Direction: 5' | Facility: INRA |
Sequence |
Sequence Id: SGN-E376420 | Length: 200 bp (918 bp untrimmed) |
Status: Current Version | Direction: 3' [See links to 5' reads above] |
>SGN-E376420 [] (trimmed)
AGGTGTTTTCTCATTGGCTGCTGAAGGAGAGGCTGGAGTGAAAAAAGTGCTGCAAATGTTGCGCGATGAGTTTGAGCTAACTATGGCATTGAGTG
GCTGTCGCTCACTGAAGGAGATTACTAGAAACCACATTGTCACTGAATGGGACACCCCACACGCTGCTCTTCCAGCCCCAAGGTTGTGAGCATGT
ACCTGCCCGG
GCTGTCGCTCACTGAAGGAGATTACTAGAAACCACATTGTCACTGAATGGGACACCCCACACGCTGCTCTTCCAGCCCCAAGGTTGTGAGCATGT
ACCTGCCCGG
Unigenes |
Current Unigene builds | |||||
[SGN-E376420] | SGN-U578941 | Tomato 200607 | Build 2 | 184 ESTs assembled | |
Follow SGN-U# link for detailed information and annotations |
Chromatogram |
SGN-ID: SGN-T188460 [Download][View] | Facility Assigned ID: FA0AAD36BH07FM1 |
Submitter: Koni | Sequencing Facility: INRA |
Quality processing |
Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
Sequence Entropy: 0.000 | Expected Error Rate: 0.0000 | Quality Trim Threshold: 0 |