EST details — SGN-E376414

Search information 
Request: 376414Match: SGN-E376414
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C186012Clone name: TUS-48-O2
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C186012 is on microarray TOM1 spot ID 1-1-7.3.7.7 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C77623 [cLES-2-L16] Trace: SGN-T97235 EST: SGN-E282075 Direction: 5' Facility: TIGR
Clone: SGN-C186012 [TUS-48-O2] Trace: SGN-T188455 EST: SGN-E376415 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E376414Length: 319 bp (901 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E376414 [] (trimmed) AGGTACTACGCAGTGGATGGAAGACAATCAAAGCTGCACTGGCAATGCCACTGATGATTGAAGGATACAAGAAAGGTCTCATCAAATTTGCCATC
ATCACATGTCGAAAACCTGAATAATTATTGCTTAGCTACTGATGAATAATACAACATCTATGGATCTTGGAATGGAAGAAAAATAAACTAATCTA
TTAAGTAAAGAAAATGCAACATTGAATGAACTCTGGATTGCAAAGCTCAAGAAATTGCCACATTTGCTACAATAGCCTTAAATTTTAATATTCCA
TTTAAAATATTGTATTGTGAAATTGCCACATTGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E376414] SGN-U584511 Tomato 200607 Build 2 28 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T188454 [Download][View] Facility Assigned ID: FA0AAD36BH01FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: Multiple cloning site sequence detected -- chimeric clone suspected.
Passed all screens and filters
Sequence Entropy: 0.000 Expected Error Rate: 0.0000 Quality Trim Threshold: 0