EST details — SGN-E376401
| Search information |
| Request: 376401 | Match: SGN-E376401 |
| Request From: SGN database generated link | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C185934 | Clone name: TUS-48-K20 |
| ||
| Library Name: TUS | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:
Microarray: SGN-C185934 is on microarray TOM1 spot ID 1-1-5.3.7.14 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
| Clone: SGN-C73279 [cLER-4-B19] | Trace: SGN-T92941 | EST: SGN-E278108 | Direction: 5' | Facility: TIGR |
| Clone: SGN-C185934 [TUS-48-K20] | Trace: SGN-T188440 | EST: SGN-E376400 | Direction: 3' | Facility: INRA |
| Sequence |
| Sequence Id: SGN-E376401 | Length: 227 bp (938 bp untrimmed) |
| Status: Current Version | Direction: 5' [See links to 3' reads above] |
>SGN-E376401 [] (trimmed)
CCGGGCAGGTACCTTGCAGAGTAAGGCTTGCCACTAGGACCAGGGTCTTTCAAGTCATCGATATATTTTTTCAACTTGTCATCCCAGAGCTGGTA
GTTTCCTTCATTGAATGAATAGATCTTTCCAGACTTTGGTATTTGGACATTTTCTTGAGTCAGAACAAATTCTCCATACATTGGATCCAAGTTAA
AGGAAAAAACGCCATTTCCCAAGGTGAGTACCTCGGC
GTTTCCTTCATTGAATGAATAGATCTTTCCAGACTTTGGTATTTGGACATTTTCTTGAGTCAGAACAAATTCTCCATACATTGGATCCAAGTTAA
AGGAAAAAACGCCATTTCCCAAGGTGAGTACCTCGGC
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E376401] | SGN-U583766 | Tomato 200607 | Build 2 | 49 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T188441 [Download][View] | Facility Assigned ID: FA0AAD36BF10RM1 |
| Submitter: Koni | Sequencing Facility: INRA |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.878 | Expected Error Rate: 0.0075 | Quality Trim Threshold: 14.5 |


