EST details — SGN-E376276

Search information 
Request: 376276Match: SGN-E376276
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C185744Clone name: TUS-48-C22
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C185744 is on microarray TOM1 spot ID 1-1-3.3.7.12 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E376276Length: 135 bp (891 bp untrimmed)
Status: Current VersionDirection: 3'
>SGN-E376276 [] (trimmed) GCTCATGACTTAAAGATTGCAGATTCAATGCTTAATCAATGGATTAGCAACTAGATGAGAAAGGGGTACTATGTTCTTTAATACAAGTGCATATT
ATATTTTTGGTTTACCATCAATTGATTGGCTTAATCGTAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E376276] SGN-U568957 Tomato 200607 Build 2 13 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T188316 [Download][View] Facility Assigned ID: FA0AAD36BB11FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read -- flanking 5' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.911 Expected Error Rate: 0.0162 Quality Trim Threshold: 12.5