EST details — SGN-E376273

Search information 
Request: 376273Match: SGN-E376273
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C185734Clone name: TUS-48-C12
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C185734 is on microarray TOM1 spot ID 1-1-5.3.7.8 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C185734 [TUS-48-C12] Trace: SGN-T188312 EST: SGN-E376272 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E376273Length: 239 bp (951 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E376273 [] (trimmed) AGGTACCCTGATCTTCGTATTCGCAGGTCAGGGTTCTGGTATGGCTTTCAATAAGCTTACCGATGGCGTCGCTACTCCCGCTGGCCTTATTTCCG
CCTCCATAGCACACGCCTTCGGGTTGTTCGTCGCCGTCTCCGTCGGTGCTAACATCTCCGGCGGCCACGTCAACCCTGCTGTTACCTTCGGTGCT
TTTGTTGGTGGAAACATCACTTTGTTCCGTGGAATTTTGTACCTGCCCG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E376273] SGN-U581024 Tomato 200607 Build 2 145 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T188313 [Download][View] Facility Assigned ID: FA0AAD36BB06RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: Multiple cloning site sequence detected -- chimeric clone suspected.
Passed all screens and filters
Sequence Entropy: 0.000 Expected Error Rate: 0.0000 Quality Trim Threshold: 0