EST details — SGN-E376151
| Search information |
| Request: 376151 | Match: SGN-E376151 |
| Request From: SGN database generated link | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C185927 | Clone name: TUS-48-K13 |
| ||
| Library Name: TUS | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:
Microarray: SGN-C185927 is on microarray TOM1 spot ID 1-1-4.3.7.10 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
| Clone: SGN-C72942 [cLER-2-K4] | Trace: SGN-T92485 | EST: SGN-E278767 | Direction: 5' | Facility: TIGR |
| Clone: SGN-C185927 [TUS-48-K13] | Trace: SGN-T188190 | EST: SGN-E376150 | Direction: 3' | Facility: INRA |
| Sequence |
| Sequence Id: SGN-E376151 | Length: 198 bp (913 bp untrimmed) |
| Status: Current Version | Direction: 5' [See links to 3' reads above] |
>SGN-E376151 [] (trimmed)
AGGTACAATTTTTCTTGCTGTATGACAATGTAGGAGGTTAGATTTGCTAGTGTGCACAAATCCCATCAAGCACACGCATGAATAGCAATCACTAA
TTTTGGAACCTTGACTCATCTCTCTGGATCTACAAATGCAGTGTGAAATGTTTCTTTTTATTCTTTTGGTTTTAATGAAGAAATGATTGGTTTCT
TTATGGAT
TTTTGGAACCTTGACTCATCTCTCTGGATCTACAAATGCAGTGTGAAATGTTTCTTTTTATTCTTTTGGTTTTAATGAAGAAATGATTGGTTTCT
TTATGGAT
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E376151] | SGN-U579007 | Tomato 200607 | Build 2 | 52 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T188191 [Download][View] | Facility Assigned ID: FA0AAD36AF07RM1 |
| Submitter: Koni | Sequencing Facility: INRA |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.877 | Expected Error Rate: 0.0078 | Quality Trim Threshold: 12.5 |


